Begomovirus Transmission to Tomato Plants Is Not Hampered by Plant Defenses Induced by Dicyphus hesperus Knight.

Plants can respond to insect infestation and virus infection by inducing plant defenses, generally mediated by phytohormones. Moreover, plant defenses alter host quality for insect vectors with consequences for the spread of viruses. In agricultural settings, other organisms commonly interact with plants, thereby inducing plant defenses that could affect plant-virus-vector interactions. For example, plant defenses induced by omnivorous insects can modulate insect behavior. This study focused on tomato yellow leaf curl virus (TYLCV), a plant virus of the family Geminiviridae and genus Begomovirus. It is transmitted in a persistent circulative manner by the whitefly Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae), posing a global threat to tomato production. Mirids (Hemiptera: Miridae) are effective biological control agents of B. tabaci, but there is a possibility that their omnivorous nature could also interfere with the process of virus transmission. To test this hypothesis, this study first addressed to what extent the mirid bug Dicyphus hesperus Knight induces plant defenses in tomato. Subsequently, the impact of this plant-omnivore interaction on the transmission of TYLCV was evaluated. Controlled cage experiments were performed in a greenhouse setting to evaluate the impact of mirids on virus transmission and vector acquisition by B. tabaci. While we observed a reduced number of whiteflies settling on plants exposed to D. hesperus, the plant defenses induced by the mirid bug did not affect TYLCV transmission and accumulation. Additionally, whiteflies were able to acquire comparable amounts of TYLCV on mirid-exposed plants and control plants. Overall, the induction of plant defenses by D. hesperus did not influence TYLCV transmission by whiteflies on tomato.

Aphid gene expression following polerovirus acquisition is host species dependent.

Upon acquisition of persistent circulative viruses such as poleroviruses, the virus particles transcytose through membrane barriers of aphids at the midgut and salivary glands via hemolymph. Such intricate interactions can influence aphid behavior and fitness and induce associated gene expression in viruliferous aphids. Differential gene expression can be evaluated by omics approaches such as transcriptomics. Previously conducted aphid transcriptome studies used only one host species as the source of virus inoculum. Viruses typically have alternate hosts. Hence, it is not clear how alternate hosts infected with the same virus isolate alter gene expression in viruliferous vectors. To address the question, this study conducted a transcriptome analysis of viruliferous aphids that acquired the virus from different host species. A polerovirus, cotton leafroll dwarf virus (CLRDV), which induced gene expression in the cotton aphid, Aphis gossypii Glover, was assessed using four alternate hosts, viz., cotton, hibiscus, okra, and prickly sida. Among a total of 2,942 differentially expressed genes (DEGs), 750, 310, 1,193, and 689 genes were identified in A. gossypii that acquired CLRDV from infected cotton, hibiscus, okra, and prickly sida, respectively, compared with non-viruliferous aphids that developed on non-infected hosts. A higher proportion of aphid genes were overexpressed than underexpressed following CLRDV acquisition from cotton, hibiscus, and prickly sida. In contrast, more aphid genes were underexpressed than overexpressed following CLRDV acquisition from okra plants. Only four common DEGs (heat shock protein, juvenile hormone acid O-methyltransferase, and two unannotated genes) were identified among viruliferous aphids from four alternate hosts. Gene ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations indicated that the acquisition of CLRDV induced DEGs in aphids associated with virus infection, signal transduction, immune systems, and fitness. However, these induced changes were not consistent across four alternate hosts. These data indicate that alternate hosts could differentially influence gene expression in aphids and presumably aphid behavior and fitness despite being infected with the same virus isolate.

Assessment of prickly sida as a potential inoculum source for sida golden mosaic virus in commercial snap bean farms in Georgia, United States.

Sida golden mosaic virus (SiGMV), an obligate pathogen that infects snap beans (Phaseolus vulgaris), is known to infect prickly sida (Sida spinosa L.), which is a common weed in agricultural farms in Georgia. Prickly sida has also been reported as a suitable host of sweetpotato whitefly (Bemisia tabaci), the vector of SiGMV. Despite being a host for both SiGMV and its vector, the role of prickly sida as a reservoir and inoculum source for SiGMV in snap bean farms has not been evaluated. This study was conducted to document the occurrence of SiGMV-infected prickly sida plants and to assess its potential role as a source of SiGMV inoculum in snap bean farms. A survey of 17 commercial snap bean farms conducted in spring 2021 confirmed the presence of SiGMV-infected prickly sida in southern Georgia. In fall 2021 and 2022, on-farm field trials were conducted in four commercial farms where SiGMV-infected prickly sida plants were documented earlier as a part of survey in spring 2021. The spatial distribution and temporal patterns of adult whiteflies and SiGMV on snap bean were compared between macroplots (13.7 m x 30.5 m), 'with prickly sida' or 'without prickly sida', that were at least 232 m apart from each other. We did not observe any consistent differences in counts of adult whiteflies between macroplots with or without prickly sida in the four commercial farms. SiGMV infection was detected earlier and with higher incidences in snap bean macroplots 'with prickly sida' compared with macroplots 'without prickly sida'. An apparent disease gradient was observed in two of the four farms assessed. Higher SiGMV incidences were observed on the edges of macroplots 'with prickly sida'. These findings indicate prickly sida as a potential natural reservoir and a source for SiGMV spread in snap bean farms in southern Georgia.

Characterization of gene expression patterns in response to an orthotospovirus infection between two diploid peanut species and their hybrid.

Tomato spotted wilt orthotospovirus (TSWV) transmitted by thrips causes significant yield loss in peanut (Arachis hypogaea L.) production. Use of peanut cultivars with moderate field resistance has been critical for TSWV management. However, current TSWV resistance is often not adequate, and the availability of sources of tetraploid resistance to TSWV is very limited. Allotetraploids derived by crossing wild diploid species could help introgress alleles that confer TSWV resistance into cultivated peanut. Thrips-mediated TSWV screening identified two diploids and their allotetraploid possessing the AA, BB, and AABB genomes Arachis stenosperma V10309, Arachis valida GK30011, and [A. stenosperma × A. valida]4x (ValSten1), respectively. These genotypes had reduced TSWV infection and accumulation in comparison with peanut of pure cultivated pedigree. Transcriptomes from TSWV-infected and non-infected samples from A. stenosperma, A. valida, and ValSten1 were assembled, and differentially expressed genes (DEGs) following TSWV infection were assessed. There were 3,196, 8,380, and 1,312 significant DEGs in A. stenosperma, A. valida, and ValSten1, respectively. A higher proportion of genes decreased in expression following TSWV infection for A. stenosperma and ValSten1, whereas a higher proportion of genes increased in expression following infection in A. valida. The number of DEGs previously annotated as defense-related in relation to abiotic and biotic stress was highest in A. valida followed by ValSten1 and A. stenosperma. Plant phytohormone and photosynthesis genes also were differentially expressed in greater numbers in A. valida followed by ValSten1 and A. stenosperma, with over half of those exhibiting decreases in expression.

Use of Insect Exclusion Row Cover and Reflective Silver Plastic Mulching to Manage Whitefly in Zucchini Production.

The challenges that sweet potato whitefly (Bemisia tabaci) creates for vegetable production have increased in the southeastern U.S. Growers must use intensive insecticide spray programs to suppress extremely high populations during the fall growing season. Thus, the objective of this study was to evaluate the use of a reflective plastic mulch and an insect row cover as alternative methods to the current grower practices to manage whiteflies in zucchini (Cucurbita pepo) production. Field experiments were conducted with a two-level factorial experimental design of cover and plastic mulch treatments arranged in a randomized complete block design, with four replications in Georgia in 2020 and 2021, and in Alabama in 2021. Cover treatments consisted of an insect row cover installed on zucchini beds at transplanting and removed at flowering and a no-cover treatment, while plastic mulch treatments consisted of reflective silver plastic mulching and white plastic mulching. During all growing seasons, weather conditions were monitored, whitefly populations were sampled weekly, zucchini biomass accumulation was measured at five stages of crop development, and fruit yield was determined at harvesting. Warm and dry weather conditions early in the growing season resulted in increased whitefly populations, regardless of location and year. In general, the reflective silver plastic mulching reduced whitefly populations compared to the conventional white plastic by 87% in Georgia in 2020, 33% in Georgia in 2021, and 30% in Alabama in 2021. The insect row cover treatment reduced whitefly populations to zero until its removal. Consequently, zucchini plants grown with the insect row cover and reflective silver plastic mulching had an increased rate of biomass accumulation due to the lower insect pressure in all locations. Zucchini grown using silver reflective plastic mulch and row covers had an overall increase of 17% and 14% in total yield compared to white plastic mulch and no-cover treatments, respectively. Significant differences in yield among locations were likely due to severe whitefly pressure early in the fall season, and total yields in Georgia in 2020 (11,451 kg ha-1) were 25% lower than in Georgia in 2021 (15,177 kg ha-1) and in Alabama in 2021 (15,248 kg ha-1). In conclusion, silver plastic mulching and row covers reduced the whitefly population and increased biomass accumulation and total yield. These treatments can be considered ready-to-use integrated pest management practices for growers.

Evaluation of Wild Peanut Species and Their Allotetraploids for Resistance against Thrips and Thrips-Transmitted Tomato Spotted Wilt Orthotospovirus (TSWV).

Thrips-transmitted tomato spotted wilt orthotospovirus (TSWV) causes spotted wilt disease in peanut (Arachis hypogaea L.) and limits yield. Breeding programs have been developing TSWV-resistant cultivars, but availability of sources of resistance against TSWV in cultivated germplasm is extremely limited. Diploid wild Arachis species can serve as important sources of resistance, and despite ploidy barriers (cultivated peanut is tetraploid), their usage in breeding programs is now possible because of the knowledge and development of induced interspecific allotetraploid hybrids. This study screened 10 wild diploid Arachis and six induced allotetraploid genotypes via thrips-mediated TSWV transmission assays and thrips' feeding assays in the greenhouse. Three parameters were evaluated: percent TSWV infection, virus accumulation, and temporal severity of thrips feeding injury. Results indicated that the diploid A. stenosperma accession V10309 and its derivative-induced allotetraploid ValSten1 had the lowest TSWV infection incidences among the evaluated genotypes. Allotetraploid BatDur1 had the lowest thrips-inflicted damage at each week post thrips release, while diploid A. batizocoi accession K9484 and A. duranensis accession V14167 had reduced feeding damage one week post thrips release, and diploids A. valida accession GK30011 and A. batizocoi had reduced feeding damage three weeks post thrips releasethan the others. Overall, plausible TSWV resistance in diploid species and their allotetraploid hybrids was characterized by reduced percent TSWV infection, virus accumulation, and feeding severity. Furthermore, a few diploids and tetraploid hybrids displayed antibiosis against thrips. These results document evidence for resistance against TSWV and thrips in wild diploid Arachis species and peanut-compatible-induced allotetraploids.

Effects of Host Plants and Their Infection Status on Acquisition and Inoculation of A Plant Virus by Its Hemipteran Vector.

Whitefly, Bemisia tabaci Gennadius (B cryptic species), transmits cucurbit leaf crumple virus (CuLCrV) in a persistent fashion. CuLCrV affects several crops such as squash and snap bean in the southeastern United States. CuLCrV is often found as a mixed infection with whitefly transmitted criniviruses, such as cucurbit yellow stunting disorder virus (CYSDV) in hosts such as squash, or as a single infection in hosts such as snap bean. The implications of different host plants (inoculum sources) with varying infection status on CuLCrV transmission/epidemics is not clear. This study conducted a series of whitefly mediated CuLCrV transmission experiments. In the first experiment, three plants species: squash, snap bean, and tobacco were inoculated by whiteflies feeding on field-collected mixed-infected squash plants. In the second experiment, three plant species, namely squash, snap bean, and tobacco with varying infection status (squash infected with CuLCrV and CYSDV and snap bean and tobacco infected with CuLCrV), were used as inoculum sources. In the third experiment, squash plants with differential CuLCrV accumulation levels and infection status (either singly infected with CuLCrV or mixed infected with CuLCrV and CYSDV) were used as inoculum sources. Irrespective of plant species and its infection status, CuLCrV accumulation in whiteflies was dependent upon the CuLCrV accumulation in the inoculum source plants. Furthermore, differential CuLCrV accumulation in whiteflies resulted in differential transmission, CuLCrV accumulation, and disease phenotype in the recipient squash plants. Overall, results demonstrate that whitefly mediated CuLCrV transmission between host plants follows a virus density dependent phenomenon with implications for epidemics.

Pest status, molecular evolution, and epigenetic factors derived from the genome assembly of Frankliniella fusca, a thysanopteran phytovirus vector.

BACKGROUND: The tobacco thrips (Frankliniella fusca Hinds; family Thripidae; order Thysanoptera) is an important pest that can transmit viruses such as the tomato spotted wilt orthotospovirus to numerous economically important agricultural row crops and vegetables. The structural and functional genomics within the order Thysanoptera has only begun to be explored. Within the > 7000 known thysanopteran species, the melon thrips (Thrips palmi Karny) and the western flower thrips (Frankliniella occidentalis Pergrande) are the only two thysanopteran species with assembled genomes. RESULTS: A genome of F. fusca was assembled by long-read sequencing of DNA from an inbred line. The final assembly size was 370 Mb with a single copy ortholog completeness of ~ 99% with respect to Insecta. The annotated genome of F. fusca was compared with the genome of its congener, F. occidentalis. Results revealed many instances of lineage-specific differences in gene content. Analyses of sequence divergence between the two Frankliniella species' genomes revealed substitution patterns consistent with positive selection in ~ 5% of the protein-coding genes with 1:1 orthologs. Further, gene content related to its pest status, such as xenobiotic detoxification and response to an ambisense-tripartite RNA virus (orthotospovirus) infection was compared with F. occidentalis. Several F. fusca genes related to virus infection possessed signatures of positive selection. Estimation of CpG depletion, a mutational consequence of DNA methylation, revealed that F. fusca genes that were downregulated and alternatively spliced in response to virus infection were preferentially targeted by DNA methylation. As in many other insects, DNA methylation was enriched in exons in Frankliniella, but gene copies with homology to DNA methyltransferase 3 were numerous and fragmented. This phenomenon seems to be relatively unique to thrips among other insect groups. CONCLUSIONS: The F. fusca genome assembly provides an important resource for comparative genomic analyses of thysanopterans. This genomic foundation allows for insights into molecular evolution, gene regulation, and loci important to agricultural pest status.

Characterizing the vector competence of Aphis gossypii, Myzus persicae and Aphis craccivora (Hemiptera: Aphididae) to transmit cotton leafroll dwarf virus to cotton in the United States.

Cotton leafroll dwarf virus (CLRDV) is a yield-limiting, aphid-transmitted virus that was identified in cotton, Gossypium hirsutum L., in the United States of America in 2017. CLRDV is currently classified in the genus Polerovirus, family Solemoviridae. Although 8 species of aphids (Hemiptera: Aphididae) are reported to infest cotton, Aphis gossypii Glover is the only known vector of CLRDV to this crop. Aphis gossypii transmits CLRDV in a persistent and nonpropagative manner, but acquisition and retention times have only been partially characterized in Brazil. The main objectives of this study were to characterize the acquisition access period, the inoculation access period, and retention times for a U.S. strain of CLRDV and A. gossypii population. A sub-objective was to test the vector competence of Myzus persicae Sulzer and Aphis craccivora Koch. In our study, A. gossypii apterous and alate morphs were able to acquire CLRDV in 30 min and 24 h, inoculate CLRDV in 45 and 15 min, and retain CLRDV for 15 and 23 days, respectively. Neither M. persicae nor A. craccivora acquired or transmitted CLRDV to cotton.

Cotton leafroll dwarf disease: An enigmatic viral disease in cotton.

TAXONOMY: Cotton leafroll dwarf virus (CLRDV) is a member of the genus Polerovirus, family Solemoviridae. Geographical Distribution: CLRDV is present in most cotton-producing regions worldwide, prominently in North and South America. PHYSICAL PROPERTIES: The virion is a nonenveloped icosahedron with T = 3 icosahedral lattice symmetry that has a diameter of 26-34 nm and comprises 180 molecules of the capsid protein. The CsCl buoyant density of the virion is 1.39-1.42 g/cm3 and S20w is 115-127S. Genome: CLRDV shares genomic features with other poleroviruses; its genome consists of monopartite, single-stranded, positive-sense RNA, is approximately 5.7-5.8 kb in length, and is composed of seven open reading frames (ORFs) with an intergenic region between ORF2 and ORF3a. TRANSMISSION: CLRDV is transmitted efficiently by the cotton aphid (Aphis gossypii Glover) in a circulative and nonpropagative manner. Host: CLRDV has a limited host range. Cotton is the primary host, and it has also been detected in different weeds in and around commercial cotton fields in Georgia, USA. SYMPTOMS: Cotton plants infected early in the growth stage exhibit reddening or bronzing of foliage, maroon stems and petioles, and drooping. Plants infected in later growth stages exhibit intense green foliage with leaf rugosity, moderate to severe stunting, shortened internodes, and increased boll shedding/abortion, resulting in poor boll retention. These symptoms are variable and are probably influenced by the time of infection, plant growth stage, varieties, soil health, and geographical location. CLRDV is also often detected in symptomless plants. CONTROL: Vector management with the application of chemical insecticides is ineffective. Some host plant varieties grown in South America are resistant, but all varieties grown in the United States are susceptible. Integrated disease management strategies, including weed management and removal of volunteer stalks, could reduce the abundance of virus inoculum in the field.

Sida Golden Mosaic Virus, an Emerging Pathogen of Snap Bean (Phaseolus vulgaris L.) in the Southeastern United States.

Sida golden mosaic virus (SiGMV) was first detected from snap bean (Phaseolus vulgaris L.) in Florida in 2006 and recently in Georgia in 2018. Since 2018, it has caused significant economic losses to snap bean growers in Georgia. This study, using a SiGMV isolate field-collected from prickly sida (Sida spinosa L.), examined the putative host range, vector-mediated transmission, and SiGMV-modulated effects on host-vector interactions. In addition, this study analyzed the phylogenetic relationships of SiGMV with other begomoviruses reported from Sida spp. Host range studies confirmed that SiGMV can infect seasonal crops and perennial weed species such as snap bean, hollyhock (Alcea rosea L.), marsh mallow (Althaea officinalis L.), okra (Abelmoschus esculentus (L.) Moench), country mallow (Sida cordifolia L.), prickly sida (S. spinosa), and tobacco (Nicotiana tabacum L.). The incidence of infection ranged from 70 to 100%. SiGMV-induced symptoms and virus accumulation varied between hosts. The vector, Bemisia tabaci Gennadius, was able to complete its life cycle on all plant species, irrespective of SiGMV infection status. However, SiGMV infection in prickly sida and country mallow positively increased the fitness of whiteflies, whereas SiGMV infection in okra negatively influenced whitefly fitness. Whiteflies efficiently back-transmitted SiGMV from infected prickly sida, hollyhock, marsh mallow, and okra to snap bean, and the incidence of infection ranged from 27 to 80%. Complete DNA-A sequence from this study shared 97% identity with SiGMV sequences reported from Florida and it was determined to be closely related with sida viruses reported from the New World. These results suggest that SiGMV, a New World begomovirus, has a broad host range that would allow its establishment in the farmscapes/landscapes of the southeastern United States and is an emerging threat to snap bean and possibly other crops.

A C2H2 zinc finger transcription factor of the whitefly Bemisia tabaci interacts with the capsid proteins of begomoviruses and inhibits virus retention.

Begomoviruses are a group of ssDNA viruses exclusively transmitted by the whitefly Bemisia tabaci and constrain vegetable production in the old and new worlds. Although multiple molecular determinants governing the transmission of begomoviruses by whiteflies have been unravelled, factors critical for transmission majorly remain unknown. In this study, a whitefly C2H2 zinc finger (ZF) protein, 100% identical to the vascular endothelial ZF-like gene (vezf) protein was confirmed to interact with the CP of both old- and new-world begomoviruses. This was achieved by a yeast two-hybrid (Y2H) system screening of a whitefly cDNA library using capsid protein (CP) of TYLCV as a bait. In silico annotation of vezf protein revealed that it contains a N-terminal ZF-associated domain (ZAD) alongside multiple C2H2 ZF domains on the C-terminal end. ZAD-ZF proteins form the most abundant class of transcription factors within insects. Herein, we validated the interaction of vezf with four diverse begomoviruses and its functional role in begomovirus transmission. Silencing of the vezf gene of B. tabaci led to increased retention of three diverse begomoviruses tested. Vezf is the first insect transcription factor identified to interact with plant viruses and can be crucial to understand the possible mechanisms by which plant viruses modulate transcription of their insect vectors during transmission.

Prospective Alternate Hosts of an Emerging Polerovirus in Cotton Landscapes in the Southeastern United States.

The identification of alternate hosts that can act as virus inoculum sources and vector reservoirs in the landscape is critical to understanding virus epidemics. Cotton leafroll dwarf virus (CLRDV) is a serious pathogen in cotton production and is transmitted by the cotton/melon aphid, Aphis gossypii, in a persistent, circulative, and non-propagative manner. CLRDV was first reported in the United States in Alabama in 2017, and thereafter in several cotton-producing states. CLRDV has since established itself in the southeastern United States. The role of alternate hosts in CLRDV establishment is not clear. Fourteen common plant species in the landscape, including crops, weeds, and ornamentals (cotton, hollyhock, marshmallow, country mallow, abutilon, arrowleaf sida, okra, hibiscus, squash, chickpea, evening primrose, henbit, Palmer amaranth, and prickly sida) were tested as potential alternate hosts of CLRDV along with an experimental host (Nicotiana benthamiana) via aphid-mediated transmission assays. CLRDV was detected following inoculation in hibiscus, okra, N. benthamiana, Palmer amaranth, and prickly sida by RT-PCR, but not in the others. CLRDV accumulation determined by RT-qPCR was the highest in N. benthamiana compared with cotton and other hosts. However, aphids feeding on CLRDV-infected prickly sida, hibiscus, and okra alone were able to acquire CLRDV and back-transmit it to non-infected cotton seedlings. Additionally, some of the alternate CLRDV hosts supported aphid development on par with cotton. However, in a few instances, aphid fitness was reduced when compared with cotton. Overall, this study demonstrated that plant hosts in the agricultural landscape can serve as CLRDV inoculum sources and as aphid reservoirs and could possibly play a role in the reoccurring epidemics of CLRDV in the southeastern United States.

Differential Transcriptional Responses in Two Old World Bemisia tabaci Cryptic Species Post Acquisition of Old and New World Begomoviruses.

Begomoviruses are transmitted by several cryptic species of the sweetpotato whitefly, Bemisia tabaci (Gennadius), in a persistent and circulative manner. Upon virus acquisition and circulative translocation within the whitefly, a multitude of molecular interactions occur. This study investigated the differentially expressed transcript profiles associated with the acquisition of the Old World monopartite begomovirus, tomato yellow leaf curl virus (TYLCV), and two New World bipartite begomoviruses, sida golden mosaic virus (SiGMV) and cucurbit leaf crumple virus (CuLCrV), in two invasive B. tabaci cryptic species, Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED). A total of 881 and 559 genes were differentially expressed in viruliferous MEAM1 and MED whiteflies, respectively, compared with their non-viruliferous counterparts, of which 146 genes were common between the two cryptic species. For both cryptic species, the number of differentially expressed genes (DEGs) associated with TYLCV and SiGMV acquisition were higher compared with DEGs associated with CuLCrV acquisition. Pathway analysis indicated that the acquisition of begomoviruses induced differential changes in pathways associated with metabolism and organismal systems. Contrasting expression patterns of major genes associated with virus infection and immune systems were observed. These genes were generally overexpressed and underexpressed in B. tabaci MEAM1 and MED adults, respectively. Further, no specific expression pattern was observed among genes associated with fitness (egg production, spermatogenesis, and aging) in viruliferous whiteflies. The weighted gene correlation network analysis of viruliferous B. tabaci MEAM1 and MED adults identified different hub genes potentially implicated in the vector competence and circulative tropism of viruses. Taken together, the results indicate that both vector cryptic species and the acquired virus species could differentially affect gene expression.

Persistent, and Asymptomatic Viral Infections and Whitefly-Transmitted Viruses Impacting Cantaloupe and Watermelon in Georgia, USA.

Cucurbits in Southeastern USA have experienced a drastic decline in production over the years due to the effect of economically important viruses, mainly those transmitted by the sweet potato whitefly (Bemisia tabaci Gennadius). In cucurbits, these viruses can be found as a single or mixed infection, thereby causing significant yield loss. During the spring of 2021, surveys were conducted to evaluate the incidence and distribution of viruses infecting cantaloupe (n = 80) and watermelon (n = 245) in Georgia. Symptomatic foliar tissues were collected from six counties and sRNA libraries were constructed from seven symptomatic samples. High throughput sequencing (HTS) analysis revealed the presence of three different new RNA viruses in Georgia: cucumis melo endornavirus (CmEV), cucumis melo amalgavirus (CmAV1), and cucumis melo cryptic virus (CmCV). Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed the presence of CmEV and CmAV1 in 25% and 43% of the total samples tested, respectively. CmCV was not detected using RT-PCR. Watermelon crinkle leaf-associated virus 1 (WCLaV-1), recently reported in GA, was detected in 28% of the samples tested. Furthermore, RT-PCR and PCR analysis of 43 symptomatic leaf tissues collected from the fall-grown watermelon in 2019 revealed the presence of cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and cucurbit leaf crumple virus (CuLCrV) at 73%, 2%, and 81%, respectively. This finding broadens our knowledge of the prevalence of viruses in melons in the fall and spring, as well as the geographical expansion of the WCLaV-1 in GA, USA.

Differential Transmission of Old and New World Begomoviruses by Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) Cryptic Species of Bemisia tabaci.

Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) are two of the most invasive members of the sweetpotato whitefly, Bemisia tabaci, cryptic species complexes and are efficient vectors of begomoviruses. Bemisia tabaci MEAM1 is the predominant vector of begomoviruses in open-field vegetable crops in the southeastern United States. However, recently B. tabaci MED also has been detected in the landscape outside of greenhouses in Florida and Georgia. This study compared the transmission efficiency of one Old-World (OW) and two New-World (NW) begomoviruses prevalent in the southeastern United States, viz., tomato yellow leaf curl virus (TYLCV), cucurbit leaf crumple virus (CuLCrV), and sida golden mosaic virus (SiGMV) between B. tabaci MEAM1 and B. tabaci MED. Bemisia tabaci MEAM1 efficiently transmitted TYLCV, CuLCrV, or SiGMV, whereas B. tabaci MED only transmitted TYLCV. Percent acquisition and retention of OW TYLCV following a 72 h acquisition access period was significantly higher for B. tabaci MED than B. tabaci MEAM1. In contrast, B. tabaci MEAM1 acquired and retained significantly more NW bipartite begomoviruses, CuLCrV or SiGMV, than B. tabaci MED. Quantitative analysis (qPCR) of virus DNA in whitefly internal tissues revealed reduced accumulation of CuLCrV or SiGMV in B. tabaci MED than in B. tabaci MEAM1. Fluorescent in situ hybridization (FISH) showed localization of CuLCrV or SiGMV in the midgut of B. tabaci MED and B. tabaci MEAM1. However, localization of CuLCrV or SiGMV was only observed in the primary salivary glands of B. tabaci MEAM1 and not B. tabaci MED. TYLCV localization was observed in all internal tissues of B. tabaci MEAM1 and B. tabaci MED. Overall, results demonstrate that both B. tabaci MEAM1 and B. tabaci MED are efficient vectors of OW TYLCV. However, for the NW begomoviruses, CuLCrV and SiGMV, B. tabaci MEAM1 seems to a better vector.

A Review on Transcriptional Responses of Interactions between Insect Vectors and Plant Viruses.

This review provides a synopsis of transcriptional responses pertaining to interactions between plant viruses and the insect vectors that transmit them in diverse modes. In the process, it attempts to catalog differential gene expression pertinent to virus-vector interactions in vectors such as virus reception, virus cell entry, virus tissue tropism, virus multiplication, and vector immune responses. Whiteflies, leafhoppers, planthoppers, and thrips are the main insect groups reviewed, along with aphids and leaf beetles. Much of the focus on gene expression pertinent to vector-virus interactions has centered around whole-body RNA extraction, whereas data on virus-induced tissue-specific gene expression in vectors is limited. This review compares transcriptional responses in different insect groups following the acquisition of non-persistent, semi-persistent, and persistent (non-propagative and propagative) plant viruses and identifies parallels and divergences in gene expression patterns. Understanding virus-induced changes in vectors at a transcriptional level can aid in the identification of candidate genes for targeting with RNAi and/or CRISPR editing in insect vectors for management approaches.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Whitefly-Mediated Transmission and Subsequent Acquisition of Highly Similar and Naturally Occurring Tomato Yellow Leaf Curl Virus Variants.

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids, resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (variant #2 and variant #4) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants' concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than that of variant #2 in tomato plants. Despite differences in variants' accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Impact of Host Resistance to Tomato Spotted Wilt Orthotospovirus in Peanut Cultivars on Virus Population Genetics and Thrips Fitness.

Thrips-transmitted tomato spotted wilt orthotospovirus (TSWV) is a major constraint to peanut production in the southeastern United States. Peanut cultivars with resistance to TSWV have been widely used for over twenty years. Intensive usage of resistant cultivars has raised concerns about possible selection pressure against TSWV and a likelihood of resistance breakdown. Population genetics of TSWV isolates collected from cultivars with varying levels of TSWV resistance was investigated using five TSWV genes. Phylogenetic trees of genes did not indicate host resistance-based clustering of TSWV isolates. Genetic variation in TSWV isolates and neutrality tests suggested recent population expansion. Mutation and purifying selection seem to be the major forces driving TSWV evolution. Positive selection was found in N and RdRp genes but was not influenced by TSWV resistance. Population differentiation occurred between isolates collected from 1998 and 2010 and from 2016 to 2019 but not between isolates from susceptible and resistant cultivars. Evaluated TSWV-resistant cultivars differed, albeit not substantially, in their susceptibility to thrips. Thrips oviposition was reduced, and development was delayed in some cultivars. Overall, no evidence was found to support exertion of selection pressure on TSWV by host resistance in peanut cultivars, and some cultivars differentially affected thrips fitness than others.